Что значит обои тисненые


Обои горячего тиснения: что это такое, плюсы и минусы, советы по выбору

Обои горячего тиснения — красивый, современный и прочный материал для облицовки стен. Как их производят? Какие бывают виды и что лучше выбрать? С чем не надо путать обои горячего тиснения? Каковы их плюсы и минусы?

Что такое обои горячего тиснения

Это двухслойный материал. Базовый слой может быть бумажным или флизелиновым. На базу наносится слой поливинилхлорида (он же винил). Под воздействием высокой температуры винил расплавляется и вспенивается. Затем эта эластичная поверхность обрабатывается фактурными валиками, которые делают её рельефной. Таким образом получается тисненый рисунок. 

С чем не надо путать обои горячего тиснения

Часто возникает путаница в терминах: виниловые обои, горячего тиснения, флизелиновые.

Разъясним: виниловые обои бывают без тиснения и горячего тиснения (то есть это подвид виниловых). Не путайте обои горячего тиснения на флизелиновой основе с чисто флизелиновыми обоями, которые не имеют в своем составе винила. 

 

Вам могут пригодиться

Классификация в зависимости от базового слоя

Обои горячего тиснения могут быть сделаны на бумажной или флизелиновой основе. 

Обои на бумажной основе имеют хорошую паропроницаемость (дышат), они более лёгкие и доступные по цене. Но это менее плотный, прочный и износостойкий материал. Служат 7 лет. 

Обои на флизелиновой основе более прочные, плотные, устойчивые к разрыву. Лучше скрывают неровности стен. Служат 15 лет. 

Классификация в зависимости от технологии производства

Шелкография

На основу наносят винил очень небольшой толщины, поэтому обои тонкие, гладкие, почти без рельефа. При этом материал похож на шёлк, переливается на свету и блестит. Получается очень красиво. Обычно шелкография не может похвастаться сложными рисунками — обходятся простыми узорами. Из-за того, что обои тонкие, они подходят только для ровных стен. 

Компакт-винил

При производстве на основу наносится довольно толстый слой поливинилхлорида и хорошенько вспенивается. Это позволяет сделать выраженный, глубокий и объемный рельеф. Обои компакт-винил часто имитируют природные материалы, такие как кирпичная кладка, камень, кожа, текстиль, декоративная штукатурка. Обои этого вида прочные, плотные, имеют большой вес, скрывают дефекты на стенах. 

 

Вам могут пригодиться

Обои химического тиснения

Перед помещением будущих обоев в бокс с высокой температурой на определенные места винилового слоя наносятся химические вещества — ингибиторы. Их функция состоит в том, чтобы подавлять вспенивание. При нагревании большая часть винила вспенивается, а обработанные участки нет. Таким образом получается рельефный рисунок. Обои химического тиснения отличаются прочностью, износостойкостью, не выгорают на солнце, и их можно мыть. 

Плюсы 

Минусы 

Советы по выбору

Если вы ограничены в бюджете, покупайте обои горячего тиснения на бумажной основе от отечественных производителей. Также обои на бумажной основе приблизительно на 20% дешевле обоев на флизелиновой основе. Шелкографические обои, как правило, дешевле компакт-винила и обоев химического тиснения. 

Если у вас не очень ровные стены, выбирайте толстые рельефные обои типа компакт-винил или химического тиснения (они же ингибиторные). Если стены ровные, можно также смотреть в сторону шелкографии. 

Шелкографические обои выгоднее смотрятся в хорошо освещенных помещениях. Они играют на свету и переливаются. 

Если вы хотите использовать обои горячего тиснения для спальни, лучше не оклеивать ими всю комнату (из-за недостаточной экологичности). Облицуйте винилом акцентную стену, а остальные стены бумажными обоями. 

При покупке смотрите, чтобы все рулоны были из одной и той же партии. В разных партиях оттенки могут чуть-чуть различаться. Это не видно в магазине, но станет заметно после оклеивания стен.

Вам могут пригодиться

31.01.2020

Подписаться на рассылку

Что собой представляют тисненые обои

Одним из способов изменения интерьера является обновление обоев.  Рынок предлагает большое количество разнообразных по цвету и структуре материалов, которые удовлетворят любые фантазии дизайнера. Среди всего разнообразия своей декоративностью выделяются обои с рифленой поверхностью — тисненные обои.

Содержание статьи

Что такое тисненые обои

Тисненые обои — это тип обоев с рельефной поверхностью. Чаще всего тисненые обои — это двухслойные бумажные обои, верхний слой которых был специально обработан.

Тисненые обои считаются наиболее устойчивыми (минимальное растяжение при нанесении клея) и долговечными среди бумажных обоев

В настоящее время тисненые обои изготавливаются не только на толстой бумажной основе, но и на нетканой ткани, для улучшения эксплуатационных характеристик отделочного материала используются поливинилхлоридные обработки.

Способ изготовления тисненых обоев

Первоначально выполняется глубокая печать хорошего качества на внешней поверхности, которая наклеивается на нижний слой и подаётся на приспособление для создания рельефного рисунка.

Тиснение — это процесс придания поверхности определенного рисунка или выпуклости под давлением. Таким образом, само название объясняет его тип.

Тиснение выполняется сухим, сырым, горячим и химическим способом. Далее идёт просушка, создание рулонов и их упаковка. Основанием тисненых обоев служит плотная бумага или флизелиновое полотно.

Читайте также: Особенности флизелиновых обоев

Бумажные тисненые обои

Тисненые бумажные обои называются иначе — дуплекс с рельефной поверхностью. Обои состоят из двух слоев бумаги — подложки и верхнего покрытия. Дуплекс с тиснеными или набивными обоями — для покраски. Дуплекс под роспись отличается более четким рельефом.

Дуплекс с рельефной поверхностью выпускается под покраску, поэтому имеет более рельефную поверхность, которая при многократном окрашивании искажается.

Положительные свойства этих обоев заключаются в возможности маскирования шероховатой поверхности, их прочность, экологическая чистота.

К недостаткам: не рекомендуется применять в комнатах с влажной средой и сравнительно небольшая долговечность (5 лет).

Виниловые обои с шелкографией

Виниловые обои горячего тиснения бывают трёх видов: с эффектом шёлкографии, тяжёлые виниловые и плоский винил (компакт-винил). Все они изготавливаются по одной технологии: на плотную бумагу (основание) наносится вспененный ПВХ и помещается для нагрева в специальную камеру. Размягчённую поверхность формируют различными валиками.

Виниловые обои долговечны (7- 15 лет), удобны в уходе, но оклеенное ими помещение требует более частое проветривание.

Статья по теме: Красота виниловых обоев

Обои с эффектом шелкографии тонковаты и, чтобы скрыть мелкие неровности, необходима тщательная обработка поверхности.

Виниловые обои химического тиснения производятся с помощью химического реагента, который наносится на отдельные участки для подавления вспученности вспененного винила. Эта технология позволяет создать оригинальный цветовой эффект путём удачного сочетания двух способов отделки.

Кроме этого, эти обои имеют долгий срок службы (10-15 лет), выдерживают прямые солнечные лучи и механическое воздействие. К недостаткам можно отнести высокую цену и нескрываемые шероховатости и неровность поверхности.

Читайте также: Особенности кварцевых обоев

Поклейка обоев

Рельефные обои просты в установке. Но это настенное покрытие очень трудно удалить со стены. Чем приклеивать обои обычно указано на упаковке.

Оклеивание обоями на бумажной основе

Лучше воспользоваться некоторыми советами при оклеивании стен: работать в помещении, где температура должна быть 15-22 градуса тепла по Цельсию; не допускать сквозняков; случайно попавший клей на лицевую сторону надо промокнуть губкой, а не растирать.

Оклеивание флизелиновыми обоями горячего теснения

Перед началом работ необходимо проверить, что никакие загрязнения стен не будут просвечиваться через обои. Клей должен быть более густым и не желтеть после высыхания.

Применение тисненых обоев очень украсит помещение, добавив свежести даже неприхотливому интерьеру.

Заключение

Рельефные обои — это стильный вариант для любых комнат в доме. Если вы ищете какую-нибудь захватывающую фактуру на стенах или потолке, тисненые обои — отличный выбор.

Рекомендую посмотреть

Тисненые обои: преимущества, недостатки, технология наклейки

Вот, вроде бы, и слышишь время от времени о таком понятии, как тисненые обои, а что, собственно, на них «вытеснено», мало задумываешься. Так давайте же, в конце концов,  развеем все сомнения и предпосылки, благодаря этой статейке, которая поведает вам обо всех преимуществах, недостатках и технологиях наклейки тисненых обоев.

Тисненые обои – один из типов бумажных обоев, которые еще называют рельефными. Их производят из двух слоев бумаги. Тиснение – это рельефный рисунок. Он возникает в результате использования валиков, которые установлены на специальную машину и, благодаря специальным выпуклостям, оказывают высокое давление на бумагу. За счет этого и получается рельеф на обоях. Когда рисунок уже нанесен, обои окрашивают.

Тисненые обои также могут скрывать небольшие неровные участки стен, благодаря своей фактуре. В этом заключается их преимущество перед обычными обоями. Специально для покраски существует и текстурный вид обоев. То бишь, после наклейки ими стен, вы смело можете красить покрытие в любой цвет, который вам нравится. Такие обои покрывают специальным водоотталкивающим веществом. Рельеф тисненых обоев создаст особую игру света и теней на всей плоскости стен, что придаст им необыкновенно эстетический вид. Заказать тиснение можно тут http://www.delsastyle.ru/tisnenie.html причем на разных материалах.

Недостаток тисненых обоев, как в прочем, и всех обычных бумажных, заключается в маленькой прочности сравнительно с виниловыми или текстильными обоями. Перед тем, как начать наклеивать обои, необходимо избавиться от остатков старых обоев, убрать все неровности, то есть тщательно подготовить почву для дальнейшей работы. Когда будете выбирать обои, обращайте внимание на их серию и качество. Они должны быть одинаковыми.

В процессе оклеивания необходимо выполнить следующие действия:
1. Полотна обоев нарезать на уровне высоты стен.
2. При нанесении тонкого слоя клея на обои лучше всего  использовать современные его марки. Он надежно покроет весь участок обоев, не оставив сухого места на них.
3. Необходимо сложить обои так, чтобы оба края были до средины полотна обоев и концы их соприкасались. После этого сложить их вдвое еще раз.
4. Ждем десять минут, пока клей впитается в бумагу.
5. Клеить обои нужно начинать с верхней части стены так, чтобы они немного заходили друг на друга, ибо они обязательно уменьшаются в размере после высыхания.
6. Дальше сверху вниз начинаем разглаживание. Начинаем с середины полотна обоев и постепенно переходим к краям.
7. Дыры для розеток в обоях делаем после их высыхания. Так будет лучше.

При клейке обоев необходимо также учитывать и температуру помещения. Так как при сильной жаре летом либо зимой при батарее материал будет плохо схватываться со стенами. Лучше всего наклейкой заняться весной, тем же летом (но при температуре не выше 25 градусов по Цельсию), или ранней осенью, что обеспечит вам медленное и равномерное высыхание.

плюсы и минусы обоев на флизелиновой основе

Можно ли мыть флизелиновые обои

Если вы увидели соответствующее обозначение на обоях, значит, мыть их точно можно. Сохнут они довольно быстро, только не переусердствуйте с мытьем.

Для удаления жирных пятен можно применить тальк

Советы по чистке обоев:

Гладкие с флоком обои также разрешено мыть теплой водой с растворенным мылом. Если на обои попал лак, можно убрать его жидкостью для снятия лака.

Как выбрать виниловые обои?

Выбирая материалы для ремонта, нам зачастую трудно определиться, какие виниловые обои лучше. Для начала надо решить, где конкретно вы хотите сделать эффектные стены из модного покрытия.

Для ванной и кухни выбор однозначен — это полиплен. Моющиеся виниловые обои лучше всего выбир

Что значит тисненые обои. Что представляют собой тисненые виниловые обои на флизелиновой основе. Виды винилового покрытия

Выбор обоев - это очень важное решение в процессе любого ремонта. Кто-то любит клеить «на века» и выбирает материалы, способные сохранять эффектный вид 8-10 лет, кто-то, наоборот, предпочитает менять облик стен каждые 2-3 года.

Необходимое соотношение цена-качество, интересный цвет и всевозможные узоры, влагоустойчивость, способность пережить царапины, удары и детские рисунки - идеальные обои должны соответствовать всем этим качествам. По этой причине представители самых разных слоев населения все чаще выбирают виниловые обои для стен.

Этот тип обоев отличается красивым, насыщенным рисунком

Главные плюсы виниловых обоев

Виниловые обои - это особая разновидность покрытия для стен в виде рулонов с основой из дешевой бумаги или более дорогого и престижного флизелина. Сверху - слой поливинилхлорида (в народе - винила) разной толщины, структуры и объема.

В огромной массе виниловых покрытий для стен множество подвидов, но все они обладают общими преимуществами, благодаря которым и полюбились покупателям.

Это позволяет подобрать двухслойное покрытие для стен в дома и квартиры, оформленные в любых стилях: строгая классика, изящное ретро, уютное кантри, лаконичный хай-тек, промышленный лофт и другие.

Обои с моющимся слоем можно использовать для оклейки ванной

Недостатки виниловых обоев

При всех своих плюсах у стройматериалов из поливинилхлорида есть ряд недостатков, которые, тем не менее, всегда можно исправить.

Что такое обои горячего тиснения, виды, преимущества и недостатки

В поисках современных материалов для отделки стен, которые будут иметь адекватную стоимость, внешнюю привлекательность и хорошие эксплуатационные характеристики, многие склоняются к обоям. Среди огромного ассортимента товаров можно найти обои горячего тиснения. Они отличаются от своих стандартных собратьев и имеют ряд преимуществ. В чем их особенность и как правильно выбрать полотна для себя?

Характеристика изделий горячего тиснения

Примечательно, что это не новый вид обоев, а просто измененный процесс создания полотен из все тех же материалов. Обои горячего тиснения представляют собой продукт особой технологии, при которой полотно из бумаги, флизелина или винила обрабатывается в специальной печи и на поверхности появляется определенный узор или рисунок.

За счет того, что на основание нанесен сплошной полимерный слой, под влиянием высокой температуры он начинает размягчаться. Фактура и рисунок формируются после воздействия на полотна валиков. Разновидности валиков: из металла тиснящий и из резины прижимной. Это и есть горячее тиснение.

Вредные вещества, такие как формальдегидные смолы, в процессе нагревания испаряются из винила, поэтому он становится безопаснее. Не зря полотна горячего тиснения имеют сертификат европейской независимой экологической экспертизы.

Если соблюдать рекомендации по ходу эксплуатации, то обои горячего тиснения прослужат от 7 до 15 лет. Получается, что шпалеры подойдут не только для жилых помещений, но и для санузлов и кухонь. Их можно очищать салфетками с использованием щадящих чистящих средств. А для новичков будет радостно услышать, что клеить их просто на любые поверхности.

Особенности и виды

Тисненные обои представляют собой изделия, состоящие из двух слоев. Их основа может быть разной, но под воздействием высокой температуры и прессования верхний слой начинает вспениваться. Однозначно, среди рядовых пользователей обои горячего тиснения являются самыми популярными. Существует несколько разновидностей таких изделий.

Виниловые обои горячего тиснения

В продаже они появились недавно, отличаются высоким качеством, могут быть моющимися и позволяют создать оригинальный дизайн в помещении. Радует и большой ассортимент цветов и рисунков.

Состав: основа, сделанная из бумаги или флизелина. Бумажный вариант более дешевый, но имеет много минусов, флизелоновая основа дороже, но лучше в эксплуатации. Вторым слоем наносится поливинилхлорид. Он и формирует внешний вид изделий горячего тиснения. Количество винила зависит от дизайнерской задумки.

Существует несколько вариантов производства подобных изделий:

  1. Шелкография. Это подобие шелковой ткани, которое достигается за счет особой технологии создания. На основу наносится тонкий слой поливинилхлорида. Плотность составляет от 90 до 130 г/м2. При этом фактура у изделий не является ярковыраженной. Главная особенность в том, что объемный рисунок получается не благодаря толстому слою винила, а благодаря преломлению света, если смотреть на полотна горячего тиснения под разными углами. Они переливаются и блестят.
  2. Винил горячего тиснения. Другое название таких обоев – тяжелый винил или контакт-винил. Особенность продукции в том, что она обладает плотным верхним слоем, достигающим 250 гм/2. Полотно сильно вспененное, как и ярковыраженный рельеф на поверхности. Изделия имеют большой вес и очень фактурные. Благодаря простому методу изготовления тисненых обоев, есть возможность создать имитацию натуральных материалов. Получаются кирпичные, бетонные, оштукатуренные, тканные или кожаные стены.
  3. Ингибиторы. Это еще один вариант нанесения слоя винила на поверхность. Он сводится к реакции полотна на химические реагенты. На виниловое основание наносятся ингибиторы, в зависимости от выбранного рисунка. Благодаря этому винил в данных местах не будет вспениваться. Так ингибиторы позволят создать определенный узор на поверхности. У материала высокая прочность, устойчивость к УФ-лучам, полотна не боятся влаги. Поверхность гладкая, глянцевая.

Основа из флизелина

Виниловый слой наносится на основу из флизелина. Это прочный, надежный и качественный материал, который имеет массу преимуществ. И несмотря на то, что такие обои немного тяжелее и дороже бумажных, прослужат изделия горячего тиснения в разы дольше.

Преимущества флизелиновой основы:

  1. Безопасность и экологическая чистота. Материал не вредит здоровью и является гипоаллергенным. Часто подобные варианты выбирают в комнаты с детьми или если в доме живет домашнее животное.
  2. Свойство «дышать». Материал пропускает воздух, а это огромное преимущество. Внутри создается оптимальный микроклимат, стены не будут покрываться конденсатом, отсыревать. Как результат, никакого грибка и плесени. Естественное проветривание в комнате.
  3. Форма. Флизелин позволяет полотнам горячего тиснения отлично сохранять первоначальную форму спустя многие годы после монтажа. Качественные шпалеры прослужат десяток лет без деформации и потери цвета.
  4. Разнообразие дизайна. Появляется масса возможностей декорирования комнаты обоями. Это не только цвета, но и фактура, узоры и рисунки на поверхности. Изделия можно будет перекрашивать.
  5. Способны замаскировать незначительные дефекты на поверхности.
  6. Универсальный тип. С материалом не только просто работать, он используется для разнообразных поверхностей, будь то бетонные стены, гипсокартонные или кирпичные. Есть возможность даже работать с поверхностями из ДСП.
  7. Простота демонтажа. Обои горячего тиснения не нужно размачивать или пропаривать. Достаточно подцепить шпалеру шпателем и снять.

Недостатки:

  1. Высокая стоимость, если сравнивать с дешевыми бумажными аналогами. Но, качество того стоит.
  2. Если флизелин не покрыт дополнительной защитой, то его нельзя мочить. То же касается и влажной уборки. Для очистки используется только пылесос.

Основа из бумаги

Такие обои горячего тиснения состоят из двух слоев, первый из которых базовый или основа, а второй – декоративный. Именно он отвечает за будущий внешний вид шпалер. Это как однотонные полотна, так и изделия с ярким рисунком.

Все обои, которые имеют два слоя, называются дуплекс, что в переводе означает «двойной».

Некоторые виды разрешается красить. Преимущества подобных изделий горячего тиснения в следующем:

  1. Бумага – натуральный материал. Благодаря ему в помещении создается оптимальный микроклимат, стены дышат и не зацветают. Обои никак не влияют на здоровье.
  2. Могут маскировать или скрывать мелкие трещины, шероховатости и потертости.
  3. За счет двух слоев, материал надежнее и долговечнее, чем однослойный собрат.
  4. Процесс создания не несет за собой использования химических средств. Значит, в процессе нагревания обои не будут выделят едких и токсичных запахов.
  5. Низкая стоимость. Это делает изделия доступными и такими популярными.

Минусы:

  1. Боятся влаги, поэтому нельзя использовать в кухне, ванной комнате или других влажных помещениях. Дети могут запачкать их, а очищать полотна водой запрещено.
  2. Основа непрочная, поэтому ее легко повредить, снизив эксплуатационный срок. Он и так составляет 5 лет.
  3. Ширина полосы составляет 53 см, метровых изделий в продаже нет. Это значит, что стыков на стене будет больше, что не делает внешний вид лучше. А процесс наклеивания замедлится.

Каждый сам решает, какие обои выбрать для отделки помещения. Если есть перечень плюсов и минусов, то достаточно сравнить их решиться. В любом случае, изделия горячего тиснения – это прекрасный вариант для создания уюта и современного интерьера. Они долговечные, не боятся влаги, УФ-лучей и перепадов температур. А проблем с наклеиванием на разные поверхности стен вовсе не возникнет.

Важный фактор в том, что обои горячего тиснения способны поддерживать тепло и имеют хорошую звукоизоляцию. Это особенно актуально для панельных домов. Если тот факт, что тисненные шпалеры легко повредить не беспокоит, то остается пойти в магазин и выбрать для себя оптимальный вариант.

Что такое тиснение? (с изображением)

Тиснение - это художественная техника, при которой создается узор на таком материале, как бумага, металл, ткань, кожа или дерево. Узор может быть рельефным или рельефным, в зависимости от того, как он тиснен. Многие потребители взаимодействуют с такими предметами на регулярной основе, начиная от обложек книг и заканчивая нотариально заверенными документами. Как художественная техника, тиснение существует уже сотни лет, с многочисленными артефактами, от кожаных ремней с тиснением до металлических украшений со следами этих узоров.

Должностные лица, такие как нотариусы, используют ручные штампы для тиснения.

Есть несколько способов тиснить что-нибудь. Некоторые художники делают это вручную, используя ручные инструменты для нанесения рисунка на тисненый материал. Эта техника позволит создать уникальный рельефный дизайн, который невозможно воспроизвести.Этот стиль часто используется для индивидуальных художественных проектов, или когда заказ штампа для тиснения может показаться непрактичным. В таких проектах используются техники как сухого, так и теплового тиснения, в зависимости от того, как художник хочет, чтобы готовое изделие выглядело.

В другом типе используется матрица или ролик.Валики используются для непрерывного тиснения, например, для изготовления кожи с однородным рисунком. Штамп выполняет тиснение по одному куску материала за раз, но его можно использовать снова и снова. Как на штампах, так и на роликах, рисунок вырезается в обратном направлении, так что, когда матрица прижимается к материалу, желаемый рисунок проявляется в правильной форме. Как правило, матрица предназначена для установки в пресс, а не вручную. Как штампы, так и ролики также могут использовать тепло для большей эффективности.

В печати тиснение может значительно увеличить расходы на печать. Обычно он представляет собой отдельный проход через печатную машину, если только штамп не предназначен для нанесения краски. Чаще всего печатные материалы имеют «слепое тиснение», что означает, что это делается без использования чернил.При использовании этого метода важно убедиться, что штамп правильно зарегистрирован, чтобы он совпадал с рисунками, нанесенными чернилами, которые были созданы в первую очередь. Тиснение также может использоваться при изготовлении бумаги для четкой печати отдельных листов бумаги, чтобы их можно было идентифицировать для потребителей.

Государственные нотариусы и другие должностные лица используют ручные штампы для тиснения для маркировки документов из своих офисов.Такой шаблон может быть сложно подделать, чтобы документ был официальным и отличительным. Ручные штампы для тиснения можно заказать в многочисленных специализированных компаниях-поставщиках, и они чрезвычайно просты в использовании. Они также удобны для маркировки личных вещей, например книг.

.

определение тисненого по The Free Dictionary

Он одет в самом лихом и фантастическом стиле; уздечки и крупы весомо тиснены бисером и кокардами; а голова, грива и хвост переплетены обилием орлиных перьев, развевающихся на ветру. За ними солдаты и офицеры несли большую темнолицую икону с тисненой металлической крышкой; на боку висела красивая сабля, его ножны украшены тиснеными рыцарями и плачущими женщинами. Сламки - тот Трущоб, которого мы, задолго до того, как он получил свое нынешнее благородное и высокое положение, предсказывали, однажды станет, как он сейчас, высшей честью своей страны, а ее самое гордое хвастовство: как ее смелый защитник, так и ее честная гордость - мы говорим, что наш современник-рептилия развеселился за счет великолепно рельефного тисненого ведра для угля, подаренного этому славному человеку его восхищенными избирателями, и на покупку которого, намекает безымянный негодяй, достопочтенный мистерНа нем и в нем, поднимаясь сквозь него, по мере того как обломки поднимаются по песку, были украшенные драгоценными камнями слоновьи хауда из тисненого серебра, усыпанные пластинами из кованого золота, украшенные карбункулами и бирюзой. Из-под откидного створки огромного кармана корабля. Загрязненный жилет из тисненого шелка, сильно украшенный потускневшим серебряным кружевом, являл собой инструмент, который, если его увидеть в такой боевой компании, можно было легко принять за какое-нибудь озорное и неизвестное орудие войны. - сказал Император, вставая в своих Императорских одеждах, которые он сам надел, и закрепляя свой меч, богато украшенный золотом.Некоторые фрагменты былого великолепия то тут, то там на стенах этого скромного жилища; например, меч с богатой тиснением, который по своей марке принадлежал временам Франциска I, только рукоять которого, инкрустированная драгоценными камнями, могла стоить двести пистолетов, и который, тем не менее, в моменты величайшего бедствия Атос никогда не закладывал и не выставлял на продажу. Он действительно был веселым, как и сказал Робин, и прекрасной фигурой, потому что его камзол был из алого шелка, как и чулки; рядом с ним висел красивый меч, тисненые кожаные ножны были выбиты тонкими золотыми нитями; его шапка была из алого бархата, а широкое перо свисало за ухом и сзади.Сияние ее глаз, великолепные изгибы бровей, ее правильно сформированный орлиный нос, ее зубы, белые, как жемчуг, и обилие ее соболиных локонов, каждая из которых, каждая своей собственной маленькой спиралью завитых кудрей, ниспадала вниз. на такой же красивой шее и груди, как и на образе самого богатого персидского шелка, с цветами естественного цвета, тиснеными на пурпурной основе, которые были видны, все это составляло сочетание красоты, которое не уступало самым красивым из них. девы, окружавшие ее.Затем было приятное возбуждение от выбора эффектного серого степпера для экипажа Мэя (экипаж предоставили Велланды), а также постоянное занятие и интерес к обустройству его новой библиотеки, которая, несмотря на семейные сомнения и неодобрения, была доставлена. как он мечтал, с темной тисненой бумагой, книжными шкафами Истлейка и "искренними" креслами и столами. Добавьте к этому удовольствие от того, чтобы показать себя в поездках по городу и сшить свой прекрасный военный костюм, который вы он все еще восхищается скульптурой на его могиле в аббатстве Вальмон в Нормандии, и его морион, весь тисненый в Монлери, выделяется на фоне разноцветных красных и коричневых мантий олдерменов и полиции..

Что означает тиснение?

  • Emboss (глагол)

    образовывать выступы или выпуклости на поверхности; в частности, украшать рельефными изделиями

    Этимология: [Прив. эм- (л. в) + босс: ср. OF. тиснение для набухания пучками.]

  • Тиснение (глагол)

    , чтобы рельефно подниматься с поверхности в качестве украшения, головы на монете или т.п.

    Этимология: [Прив. em- (L. in) + босс: ср. OF. тиснитель набухать пучками.]

  • Emboss (глагол)

    , чтобы вспенить изо рта, как у охотящегося животного

    Этимология: [Прив. em- (L. in) + босс: ср. OF. тиснение для набухания пучками.]

  • Emboss (глагол)

    , чтобы спрятать или скрыть в чаще; имбоск; заключить, укрыть или накрыть древесиной

    Этимология: [Pref. em- (L. in) + босс: ср. OF. устройство для набухания пучками.]

  • Emboss (глагол)

    окружать; окутывать; погрузить; to beset

    Этимология: [Pref.em- (L. in) + босс: ср. OF. тиснение для набухания пучками.]

  • Рельеф (глагол)

    искать в густом лесу; спрятаться в лесу

    Этимология: [Прив. em- (L. in) + босс: ср. OF. устройство для набухания пучками.]

  • .

    WhatDoesItMean.Com

    В Новости, которые вам нужны сегодня для мира, в котором вы будете жить Завтра.

    Трамп предупреждает Теперь мы Сделать это придется нелегко As Nuclear Pearl Портовые ткацкие станки

    Ракетные удары по авиабазе США, где голосование за доминион Серверы в Германии

    Козырному матчу ждет финал Вариант После предательства Верховного суда за маской марша глубинного государства к войне

    Трамп предупреждает об этом Опасный момент в нашей истории приближается к значительному росту

    Россия готовится к ядерному оружию после Пентагона Разрывает отношения с ЦРУ и космическими силами присоединяется к ведущей шпионской группе

    Кто победил на выборах, больше не имеет значения, поскольку кусок пергамента грозит смертная казнь Судебная

    Россия издает предупреждение о выборах после Шок в Израиле показывает, что Трамп знает о Иностранцы

    Верховный суд входит в альтернативную вселенную Трампа отбрасывает выборы обратно в Safe Harbor

    Трамп проводит дерзкий митинг, одновременно развязывая крупнейшие военные Воздушный транспорт в современной истории

    Трамп активизирует план войны после того, как Верховный суд отклонил Safe Harbor Выборы

    Третья мировая война Имеет Начали в тишине Не все могут Спасайтесь

    Выборы превращаются в эпизод Звездных войн Трамп обнуляется на Core Reactor

    Выборы назначены 20 ноября, но туман войны скрывает Победитель

    Нажмите Здесь Для получения дополнительных отчетов Sorcha Faal

    Сестра Мария Тереза ​​- 73-я Сорча Фаал Сорча Фаал Орденом, избрана настоятельницей 3 февраля 2007 г.

    Теоретики заговора концентрируют свое время о трансмутации «основы» текущих событий, официальных историй, пропаганды и связей с общественностью в сияющую золотую истину, похороненную внутри.Они делают это через очень правое полушарие - раскрытие и изобретать связи между разрозненными элементами.

    Они создают сюжетные системы для понимания и объяснения событий - по сути, религиозные деятельность. По какой-то причине нам намного легче справиться с нашими внутренними содержание, проецируя их в мир вокруг нас. Эти внешние признаки неизбежно становятся носителями архетипического содержания и психодрамы, скрытой в ищущий.

    Теория заговора также преодолевает ограничения буквализма и проблемы упрощенного мышление, экспериментируя с множественностью значений.Обычные события, люди и знаки становятся символами, ощетинившимися сложными, податливыми, даже противоречивыми смыслы. Тайна возрождается и идеализируется. Факты становятся больше, чем сумма их части. Теория становится поэзией и даже теологией.

    Теории заговора не могут быть остановлены и некоторые ученые Думаю, мы бы не захотели, даже если бы могли

    Краткое История ордена Сорча Фаал Википедия: Сорча Faal Reports

    Сорча Фаал принадлежит клике еврейских женщин-ашкенази С 1290 г.Д.

    Сорча Фаал принадлежит сионистскому еврейскому преступному синдикату

    Сорча Фаал - агент дезинформации Службы внешней разведки России SVR

    Сорча Фаал работает в Центральном разведывательном управлении в г. COINTELPRO

    Сорча Фаал является частью российских государственных пропагандистских усилий

    Sorcha Faal используется DHS для составления отчета по правому крылу Экстремизм

    Сорча Фаал вступает в сговор с командой Трампа

    Сорча Фаал - место информационных войн британской МИ-6, Моссад и ЦРУ

    Сорча Фаал - часть армии троллей Путина

    Сорча Фаал - часть машины лжи Кремля и Белого дома

    Сорча Фаал Линк доказывает, что американский телеведущий Шон Хэннити - русский шпион

    Газета Guardian назвала Сорча Фаал правым крылом Помощник судьи Кавано

    Как тайные агенты проникают в Интернет с целью манипулирования, Обманывать и разрушать репутацию

    Обновление списка погибших в США за 2020 год : 3 Американцы убиты террором 1224 Американцы убиты собственной полицией

    58 Убийство американской полиции 17 Американские полицейские собаки убиты

    Американцев в 2015-2019 гг. Число погибших: Американцев, убитых собственной полицией: 5,304 Американцев, убитых террором: 271

    Правительство США называет местных граждан террористической группой №1 Полиция штата США В Ираке я совершил набег на повстанцев.В Вирджинии полиция совершила налет мне. Водители, будьте осторожны: дорогостоящие и смертельные опасности транспортных остановок В американском полицейском государстве американские шерифы просят у Пентагона больше танков для сражений Марихуана Полиция США теперь обучена тому, чтобы сначала убивать, а потом задавать вопросы Как подготовить ребенка к жизни в американской полиции Состояние? Верховный суд США постановил, что полицейские могут убивать людей, не представляющих угрозы Пока они говорят, что боялись

    Это информация американского сопротивления Сайт

    Американские участники сопротивления используют вместо него Gab Facebook.

    Американские участники сопротивления используют Parler Free Речевая сеть вместо Twitter.

    Американские участники сопротивления используют Rumble и Brighteon и Bitchute вместо YouTube

    Американские участники сопротивления делают пожертвования, используя GiveSendGo вместо GoFundMe.

    Американские участники сопротивления используют социальную сеть WeMe .

    Американцы, сопротивляющиеся созданию контента, используют Местные жители .

    Американские участники сопротивления идут на Запрещенное видео для цензурированная информация.

    Американские участники сопротивления хотят уйти последних новостей на номер Гражданская свободная пресса и Слухи Читальный зал новостей завода .

    американских сопротивляющихся смотреть новости трансляции из NewsMax и One America News Network .

    Почему G o o g l e , когда вы можете использовать сайты без отслеживания, такие как: DuckDuckGo, или Qwant, или searchX, или Хорошо Gopher ?

    Лучшие мировые новости сейчас

    14 декабря 2020 г.

    США

    Величайшее наследие Дональда Трампа: победа в войне Рождество

    Что мы знаем о кибератаке на U.С. Казначейство

    Напряжение нарастает по мере столкновения Антифа и Proud Boys Вашингтон, округ Колумбия,

    Стрелок мертв после стрельбы в соборе Нью-Йорка Рождественский концерт

    Новые подробности о повестке в Министерство юстиции США Хантеру Байдену бизнес

    Сидни Пауэлл просит Верховный суд вмешаться и отказаться от сертификации Результаты Штатов в Мичигане, Аризоне, Джорджии и Висконсине

    Адвокат говорит, что голосование Доминиона в Мичигане произошло из-за программное обеспечение, а не "человеческая ошибка"

    Шарил Атткиссон: A (довольно) завершено список (некоторых из) самых значительных заявлений о просчетах на выборах 2020 года, ошибки или мошенничество.

    Pfizer отправляет первые дозы вакцины против COVID из Мичигана Распределительный центр

    Данные показывают, что на фоне опасений перегруженности медицинских систем достаточное количество больниц по всей стране

    Федералы Получите 1 миллион долларов наличными, отправленными в Мексику на пограничном переходе

    в Калифорнии

    Россия

    Путин Подписывает приказ, требующий от государственных служащих раскрыть информацию о крипто-активах

    Кремль - Путин проходит тесты на COVID так часто, как это необходимо для его безопасности

    Министры иностранных дел России и ОАЭ для обсуждения соглашений лидеров и региональных кризисов

    МЧС заявило, что в Чеченской республике погибло 5 человек Землетрясения в течение 24 часов

    Глава здравоохранения заявил, что Россия обнаружила нулевого пациента с COVID-19

    Москва не введет комендантский час, несмотря на рост коронавируса инфекции

    Зеленский - Украина будет активно участвовать в глобальной борьбе против изменения климата

    Мир Банк предоставил Украине ссуду на 300 млн долларов на защиту малообеспеченных семей

    Десятки Задержанные в Беларуси в качестве оппозиционных этапов разбросанных маршей

    Кремль опровергает теории заговора о том, что Путин скрывается от Covid-19 в Сочи бункер, говорит президент, работающий в Москве

    Захарова - Россия оставляет за собой право за око за око ответ на антироссийские санкции Великобритании

    Китай

    Ухань Коронавирус (2019-nCoV) Живая карта глобальных случаев

    Си Цзиньпинс обещает сократить Выбросы углерода в Китае вызывают вопросы о том, движется ли Пекин достаточно быстро

    Си Цзиньпин призывает партию быть внимательной к рискам национальной безопасности

    ЕС призывает Китай освободить задержанных за репортаж после того, как сотрудник Bloomberg состоялось

    Ученые Covid-19 ищут невидимое в Ухане расследование смертельного патогена

    Пожертвования группам активистов Гонконга, оппозиция подверглась тщательной проверке, поскольку полиция замораживает банк счетов, предполагающих отмывание денег

    при поддержке США Проект мониторинга Меконга готовится проверить терпение Китая

    Чанъэ-5 завершает вторую проекцию переноса Луны на Землю, освобождается от Луны гравитация

    Южная Корея - мобилизованы сотни спецназовцев для поддержки борьбы с вирусами

    Мужчина оправдан на повторном суде через 41 год после заключения в тюрьму срок для превознесения Н.К. основатель

    Таиланд предупреждает репатриантов из Мьянмы об опасности заражения из-за штамма Covid-19 G

    Соединенное Королевство

    Лондон и Брюссель соглашаются на последний раунд торговли Разговоры, как оптимизм для сделки

    Правительство Бориса Джонсона приказало британским магазинам создавать запасы еда с часами до брексита без сделки срок

    Великобритания производители предупреждают о «нокаутирующем ударе» из-за бездействия Brexit

    Туннель плавает в качестве альтернативы мосту Галлоуэй-Северная Ирландия

    Обвинения торговца кокаином и мороженого в Северной Ирландии невежественные родители 20 долларов на пороге Санта-визитки

    Медицинский Каннабис теперь доступен в Ирландии, говорит министр здравоохранения Стивен Доннелли

    Британский Премьер-министр Борис Джонсон и глава ЕС Урсула фон дер Ляйен решат судьбу Брексита сделка

    Австралийский депутат призывает Трампа помиловать Ассанжа перед уходом из WH: Хиллари ненавидит его кишки, Байден называет его высокотехнологичным террористом

    Европейский Союз

    Женщина жестоко избита мужчинами в масках в шведской запретной зоне

    Швеция инициирует SMS-движение, чтобы уведомить жителей о правила коронавируса

    Бесчеловечное обращение: Турция обвиняет Грецию в возвращении мигрантов в турецкие воды

    Греция арестовывает двух мужчин на Родосе по подозрению в шпионаже

    Польша - Протестующие маршируют к дому вице-премьера Качиньского. после аборта постановление

    ЕС Лидеры соглашаются сократить выбросы после ночных переговоров

    Австрия конфискует оружие, предназначенное для немецких правых ополченцев

    Меркель капитуляция и худший из возможных миров: Сорос пишет сердитую статью Польско-венгерская победа на переговорах по бюджету ЕС

    Германия

    Меркель: Все возможности для достижения сделки по Брекситу добро пожаловать

    Германия отменяет Рождество: Ангела Меркель погружает страну в новый национальный запрет на праздничный сезон в отчаянной попытке снизить уровень заражения Covid

    А Секретное соглашение, позволяющее китайским шпионам свободно передвигаться по Швейцарии, было Разоблачено на этой неделе

    Рост государственного сектора маскирует кризис занятости в Швейцарии

    Швейцария - Помощники самоубийц, кто они?

    Норвегия настаивать на переходе к плохой сделке с ЕС

    Германия закроет магазины в середине недели из-за ужесточения ограничений

    Проблемы безопасности вырисовываются, поскольку Германия готовится к шести мессам Пункты вакцинации в Берлине

    Франция

    Более 100 арестованы во время митинга в Париже против закона о безопасности & Исламофобия спускается в хаос (ВИДЕО)

    Франция для открытия горнолыжных курортов 7 января

    Чарли Атака Hebdo: французская прокуратура объявила о возможности тяжелые приговоры

    Covid-19: правительство Франции обещает прозрачность на фоне широко распространенный скептицизм в отношении вакцины

    Макрон Призывы к уважению после комментариев президента Турции

    Франция требует пограничного контроля для предотвращения катания на лыжах за границей во время коронавируса

    Около 80 мечетей, подозреваемых в сепаратизме, закрываются Французское правительство начало «массированное» наступление на религиозный экстремизм

    Макрон выражает соболезнования в связи со смертью бывшего француза Президент Валери Жискар д'Эстен

    `

    Война за глобальное энергетическое превосходство - Третья мировая война

    Новые документы показывают, как тайно британское правительство Created 'Протесты против смены режима в Ливане

    США Наносит удар по Талибану на фоне сокращения численности войск в Афганистане

    Переговорщики в пользу Талибана, афганское правительство согласилось с тем, что исламские законы будут руководить мирными переговорами

    Директор ОЗХО обеспокоен правдой о химической атаке в Сирии отчет будет кормить русским повествованием

    Военно-морские силы ЛНА задержали турецкий корабль, нарушивший правила Ливии Представитель территориальных вод

    Центр для Легализация боевиков, которые сложили оружие, открывается в Юго-Западной Сирии

    США Командующий: Иранская военно-морская деятельность была уважительной

    Законопроект о финансировании обороны США от 2021 года блокирует сокращение численности войск в Германии, Афганистане, Ираке

    Интересные события

    «Экспертный консенсус» также предпочитает алкоголь Запрет

    Дополнительные данные показывают, что общее число смертей в 2020 году не отличается Чем в предыдущие годы открылась экономика для демократов

    Билл Гейтс говорит, что бары и рестораны «к сожалению» должны быть закрыт на 4-6 месяцев, без возврата к нормальному состоянию до 2022 года

    Бывший Офицер ЦРУ и эксперт по контрразведке обнаружил базу данных Обамы о преступлениях Скрывает насилие BLM и ANTIFA, но раздувает белое, правое насилие

    «Несчастный случай» в Твиттере показывает, что у Big Tech есть возможность сократить Сторонники ушли от Трампа

    Тайна Преобладает в качестве первого монолита Австралии, на котором выгравирована башня Трампа 'Координаты', исчезает

    Google Maps убирает заброшенный маршрут Road of Bones рекомендация после того, как российский водитель замерз до СМЕРТИ возле самого холодного города на Земля

    Живопись стоимостью 340 тысяч долларов найдено в немецком мусорном контейнере

    .

    Израиль

    Нетаньяху может стать первым мировым лидером, получившим вакцинацию, позже на этой неделе

    Израильская цепочка поставок подверглась масштабной кибератаке

    Пока Принимая у себя советника по национальной безопасности США Нетаньяху предостерегает от бизнеса как Обычно с Ираном

    Марокканские исламистские группировки отвергают нормализацию отношений с Израиль

    В 1-е место среди марокканских школ арабского мира по преподаванию еврейской истории и культуры

    PA руководство замалчивает сделку между Израилем и Марокко

    зарядов Подано против временного премьер-министра Ливана и трех бывших министров из-за взрыва в порту Бейрута

    Мужчина задержан за попытку открыть церковь в Иерусалиме Гефсиманский сад в огне

    Ганц поддержит законопроект о роспуске парламента и принудительном голосовании

    Турция

    Турция говорит, что иранская разведка стояла за тщательно продуманным заговором с целью похищения противника в Стамбул

    Расчет Эрдогана: Турция столкнулась с волной санкций со стороны США и Европа

    Турция вызывает посла Ирана из-за напряженности в стихотворении Азербайджана

    Я надеюсь, что Франция скоро избавится от проблем Макрона, говорит Эрдоган, на фоне растущего конфликта с ЕС

    Индейки демографические игры приходят на Кавказ

    Катар сомневается в партнерстве с Турция

    Зять Эрдогана уволился с работы в Фонде национального благосостояния

    Турция отклоняет призыв Европарламента ввести санкции в отношении Кипра

    Эрдоган говорит, что Турция видит себя частью Европы

    Египет

    В Абу-Даби начнутся клинические испытания российского Covid-19 Вакцина

    Египет Освобождает 3 задержанных сотрудника Правозащитной группы

    .

    Суданские военные арестовали Тигрея Командир ополчения

    Южная Африка

    Более 300 школьников все еще пропали без вести после школы в Нигерии атака

    Южная Африка ужесточает ограничения на COVID перед Рождеством Сезон

    Лица Рамафозы в Южной Африке Голосование недоверия на следующей неделе

    Иран

    Иран Обращается к Nuclear Watchdog из-за комментариев к плану приостановки инспекций

    Иран Вызов турецкого посланника по «сепаратисту» Эрдогана Заявления в Азербайджане

    Иран заявил о преступниках в отношении ученых-ядерщиков убийства установлены, аресты уже начаты

    Иран утверждает, что ученый-ядерщик был убит с использованием Пушка со спутниковым управлением

    Самая большая флотилия иранских танкеров находится в пути В Венесуэлу с топливом

    "Все Террористов получают образование в школах, спонсируемых Саудовской Аравией »: Iran Airs Список прачечной

    FM Зариф говорит, что Иран приветствует заявление Кувейта по разрешение строки

    Персидского залива

    Венесуэла

    Венесуэлы Оппозиция завершила «народные консультации», чтобы отклонить Мадуро

    Мадуро Надеется приехать в Россию и встретиться с Путиным в апреле-июне 2021 г.

    Мадуро говорит: готов к шагу вниз, если оппозиция выиграет парламентские выборы

    U.С. хочет шесть бывших Citgo Руководители, осужденные в Венесуэле, должны быть возвращены: Помпео

    Венесуэла возобновляет прямые поставки нефти в Китай, несмотря на санкции США

    Венесуэлы Посланник ООН призывает к Альянсу Наций против санкций США

    Венесуэльский Суд приговорил шестерых бывших должностных лиц Citgo Petroleum к Обвинения в коррупции

    Бразилия

    Верховный суд Бразилии постановил, что правительство назначило дату План вакцинации против COVID-19

    Перу приостанавливает клинические испытания китайской вакцины COVID-19

    Правительство Бразилии выпускает план вакцинации против пандемии отверстия

    Аргентина вводит единовременный сбор за личное богатство, получивший название налог миллионеров на покрытие ущерба, нанесенного Covid-19

    Автобус падает с моста в Бразилии на железнодорожные пути ниже, убито не менее 17 (ВИДЕО)

    Десятки бандитов захватывают бразильский город, ограбление банка

    Врач Марадоны провел расследование по делу о непредумышленном убийстве как дань уважения продолжить легенду

    Мексика

    Она преследовала убийц своих дочерей по всей Мексике, одна за другой Один

    Мексиканский журналист застрелен после фотографирования преступления Сюжет

    гондурасцы формирование каравана мигрантов для США остановилось на родине

    Обрадор хочет ограничить агентов США в Мексике

    США Санкционный помощник мексиканского наркобарона Кинтеро

    Обрадор ввести налоговые льготы вдоль южной границы, продлить на север

    Обрадор представляет этическое руководство по трансформации Мексика

    Протестующие подожгли здание Конгресса Гватемалы

    Куба

    Куба увеличить МРОТ в 5 раз

    Куба Чтобы положить конец старой «двухвалютной системе», существовавшей на протяжении десятилетий, отменяется конвертируемое песо

    Пуэрто-Рико: массивный телескоп обсерватории Аресибо рушится

    Протест: Куба убирает протестующих, защищающих рэпера

    Гавана открывает международный аэропорт после 7-месячного закрытия через COVID-19

    Колумбия, Куба, Юг Африка присоединяется к Договору о дружбе и сотрудничестве в Юго-Восточной Азии

    Eta бьет Кубу плетками, стремится во Флориду

    По крайней мере 26 человек погибли в Гондурасе в результате наводнения, вызванного Ураган Эта

    Организация Объединенных Наций

    Организация Объединенных Наций призывает мировых лидеров объявить ЧП

    «2021 год будет катастрофическим» - ООН предупреждает Гуманитарный кризис: 270 миллионов человек могут умереть от голода

    Коронавирус: ВОЗ рассматривает возможность электронной вакцинации сертификаты на проезд

    ООН призывает к сдержанности, чтобы избежать эскалации на Ближнем Востоке после убийства известного иранского ученого-ядерщика

    2021 год будет даже хуже, чем 2020, как предупреждает ООН 'Множественные голодоморы библейских масштабов'

    U.Н. Вождь Гутерриш требует прекратить использование угольной энергии в Сбросить мир

    Япония

    Шуга может ограничить туристическую кампанию по борьбе с вирусом в качестве одобрения рейтинг падает

    Япония ищет свалку ядерных отходов, нуждающиеся деревни Хоккайдо взять наживку, несмотря на радиационную опасность

    самоубийц унесло больше жизней в октябре, чем за 10 месяцев COVID-19 в Японии, отчет показывает

    Птичий грипп обнаружен в 3-й префектуре Японии, более 140000 человек Курицы для выбраковки

    Как Япония сообщает о 13 600 встречах медведей, почему они выходят из дикой природы?

    Vigilantes вируса угрожают людям коронавирусом Нарушения

    Шуга дает указание кабинету составить новый пакет стимулов

    Suga встречает высокопоставленного южнокорейского чиновника, вселяя надежды на Оттепель

    Пусть это идти! Премьер-министр Японии объявляет войну чернильной марке "ханко"

    Индия

    В Индии вспыхивают массовые беспорядки iPhone Завод из-за невыплаты заработной платы

    Индия готовится к 600 миллионам прививок от COVID-19; к использовать стандартный холодильный склад

    Андхра-Прадеш: «Загадочная» болезнь поражает сотни людей больница

    Пакистан

    Пакистана оппозиция возглавит марш к столице, пытаясь свергнуть Имрана Хан

    Как Премьер-министр Имран Хан потерял контроль над антифранцузской кампанией в Пакистане

    Десятки тысяч оплакивают смерть радикального священнослужителя в Пакистане

    Австралия

    Австралия отказывается от вакцины против коронавируса на миллиард долларов после Участники имеют положительный результат теста на ВИЧ

    Моррисон будет медленно вводить вакцину Pfizer

    Австралия решительно не использует спорный углерод Кредиты на цели Киотского протокола

    О компании 10 000 новых пакетов домашнего ухода будут предоставлены пожилым людям в Австралии

    Коулз присоединяется к Woolworths, чтобы продавать целых лобстеров за 20 долларов на это Рождество. супермаркеты закупают рекордное количество морепродуктов, чтобы поддержать австралийских рыбаков на фоне Китайская торговая война

    Китай-Австралия Ничья столкнется с новым ударом, поскольку Канберра получает вето на иностранные сделки

    Intel Агентство заявляет, что Пекин контролирует китайские СМИ в Австралии

    Австралия присоединяется к Индии в движении бойкота Китая

    китайский Компания, купившая австралийский остров, по сообщениям, вытесняет жителей

    Разрывают ли общество "теории заговора" или Спасает нас от гибели?

    WhatDoesItMean.Com Политика конфиденциальности и информация о ней

    Присоединиться Список рассылки Sorcha Faals

    Заговор: происходит от латинского слова «заговор». смысл дышать вместе; теории заговора подчеркивают невидимые силы и действия (эгоистичные вредные намерения особых интересов) за видимыми исторические события.

    .

    EMBOSS Часто задаваемые вопросы

    Программы и опции

    Q) Как мне сообщать об ошибках?

    А) почта [email protected]

    Q) Как мне связаться с основной командой разработчиков?

    A) Вместо того, чтобы отправлять по электронной почте их личные адреса, для EMBOSS мы просить использовать адрес:

    [email protected]

    Это гарантирует, что вашу электронную почту увидят соответствующие разработчика и что он будет зарегистрирован в нашей системе отслеживания.

    Q) Есть ли списки рассылки по EMBOSS?

    А) [email protected] открытый список (может присоединиться любой) для общих объявлений и обсуждения конечными пользователями.

    [email protected] закрытый список для обсуждения разработчиками, использующими EMBOSS.

    [email protected] закрытый список для анонсов новых релизов.

    Вы можете получить доступ к архивам, подписаться / отказаться от подписки и изменить способ отправки электронной почты (например,г. дайджесты), посетив:

    Q) Где документация?

    A) Всю документацию можно найти на следующей веб-странице http://emboss.sourceforge.net/

    Q) Где документация к приложению?

    А) http://emboss.sourceforge.net/apps/

    и в дистрибутиве EMBOSS, установленном под share / EMBOSS / doc / programs / html (файлы HTML) и share / EMBOSS / doc / programs / text (простой текст, используемый программой tfm).

    Вы также можете использовать приложение EMBOSS под названием tfm для отображения простого текстовая документация другого приложения e.г.:

     % tfm seqret 

    Q) Есть ли учебник?

    A) См. Руководство по EMBOSS на сайте: http://emboss.sourceforge.net/docs/emboss_tutorial/

    Q) Есть ли краткое руководство?

    A) Теперь доступна исправленная версия, включающая многие предложения. У меня было. Чтобы получить все, я уменьшил текст до 9pt. (извините, бесплатных луп нет), а также подготовил приписку версия.

    ftp://ftp.no.embnet.org/embnet/tutorials/EMBOSS_QG.ps (файл Postscript)

    ftp://ftp.no.embnet.org/embnet/tutorials/EMBOSS_QG.doc (формат Word 97)

    Q) Есть ли таблица заменителей программ GCG?

    A) Несколько списков доступны, но не поддерживаются EMBOSS. команда. Например: http://www.biobind.com/faq/emboss/gcg-emboss.html

    Q) Могу ли я процитировать ссылку на EMBOSS?

    А) Рис, П. Лонгден, И. и Близби, А. "EMBOSS: Открытый программный пакет европейской молекулярной биологии" Тенденции в генетике, июнь 2000 г., том 16, № 6.стр.276-277

    Q) Как мне скомпилировать EMBOSS?

    A) Если вы впервые пытаетесь скомпилировать все, что вам нужно сделать, это:
     ./configure сделать 

    Вышеупомянутое приведет к созданию программ EMBOSS в «тиснении». подкаталог, и вы можете указать свою переменную PATH, чтобы указывать туда. Этот метод подходит для разработчиков EMBOSS.

    Для общесистемной установки мы рекомендуем установить Программы EMBOSS в каталог, отличный от исходного. код (e.г. в дереве каталогов / usr / local / emboss). Делать этот тип (например):

     ./configure --prefix = / usr / local / emboss make [чтобы убедиться, что ошибок нет] сделать установку [если ошибок нет] 

    Затем вы должны добавить (например) / usr / local / emboss / bin в свой PATH переменная:

     установить путь = (/ usr / local / emboss / bin $ path) [оболочки csh / tcsh] экспорт PATH = "$ PATH: / usr / local / emboss / bin" [оболочки sh / bash] 

    Если вы хотите перекомпилировать код на любом этапе, вам следует ввести "сделать чистым", а затем сконфигурировать и снова сделать исходный код соответствующим образом.

    Q) У меня есть система Linux, и компиляция заканчивается преждевременно, говоря, что он не может найти библиотеки -lX11 ... но я знаю, что у меня есть X11 установлены.

    A) Этого не должно происходить с версиями EMBOSS старше 6.0.1. поскольку конфигурация сообщит вам об отсутствующих файлах и прекратить на этом этапе.

    Если у вас установлена ​​версия EMBOSS xorg-x11-proto-devel (дистрибутивы X11 на основе xorg) или XFree86-devel (дистрибутивы X11 на базе XFree86)

    После установки этих системных файлов вам необходимо:

     очистить 

    и повторно выполните './ configure 'сверху EMBOSS исходный каталог.

    Q) Я пытаюсь скомпилировать EMBOSS с поддержкой PNG

    A) Ваша система должна иметь zlib (www.zlib.net: текущая версия - 1.2.3), libpng (www.libpng.org: текущая версия - 1.2.35) и gd (www.libgd.org: текущая версия - 2.0.35).

    Версия GD должна быть> = 2.0.28, если она будет использоваться с EMBOSS.

    Обратите внимание, что указанные выше пакеты часто поставляются с вашей операционной системой. дистрибутив, но не может быть установлен по умолчанию i.е. Oни являются необязательными пакетами, которые вы можете установить позже.

    Также обратите внимание, что помимо установленных выше системных библиотек, вы также должны установить связанные с ними файлы разработки. (в именах пакетов в системах Linux обычно присутствует слово devel). Итак, в системах Linux RPM вам нужно убедиться, что устанавливаются пакеты с именами, похожими на "gd" и "gd-devel".

    Пользователи MacOSX часто могут найти указанные выше пакеты, доступные на Сайт MacPorts (www.macports.org).

    Однако для некоторых операционных систем бесплатное ПО может отсутствовать. сайты, где можно найти предварительно скомпилированные версии zlib / libpng / gd и вам, возможно, придется скомпилировать один или несколько из них из их исходные дистрибутивы (URL-адреса указаны выше).

    Вы можете распаковать файлы tar.gz или tar.bz2 в любой каталог и установить их в общей зоне.

    По умолчанию все (включая EMBOSS) устанавливается в / usr / local.

    Для установки возьмите исходники, а затем:

     gunzip -c zlib-1.2.3.tar.gz | tar xf - gunzip -c libpng-1.2.35.tar.gz | tar xf - gunzip -c gd-2.0.35.tar.gz | tar xf - компакт-диск zlib-1.2.3 ./configure сделать сделать установку ./configure --shared сделать сделать установку CD .. компакт-диск libpng-1.2.35 ./configure сделать сделать установку CD .. cd gd-2.0.35 ./configure --without-freetype --without-fontconfig сделать сделать установку CD .. 

    Для компиляции с локальной версией ваша строка EMBOSS ./configure теперь должна читать:-

     ./ configure --with-pngdriver = / usr / local 

    Q) При установке EMBOSS недавно я получаю массу ошибок из-за библиотеки не найдены.

    Основная проблема в том, что у меня старая версия libz, но в моих системных библиотеках нет libgd, и EMBOSS сначала смотрит туда чтобы попытаться найти эти библиотеки. У меня установлены правильные версии в другом месте. Есть ли предложения по настройке пути поиска библиотеки или мне не хватает чего-то действительно очевидного?

    А) Есть --без-pngdriver и --with-pngdriver = dir флаги.Вы их пробовали? Если библиотеки находятся в / opt / png / lib, тогда установите "dir" в / opt / png, т.е. на один уровень выше каталога "lib".

    Q) Могу ли я получить последний код через CVS?

    А) Да. Вот информация, которая вам понадобится: -

    Убедитесь, что в вашей системе есть cvs. Затем войдите на сервер cvs по адресу «open-bio.org» как: пользователь «cvs» с паролем «cvs».

     cvs -d: pserver: [email protected]: / home / repository / emboss логин Пароль: cvs. 

    Чтобы проверить дерево исходного кода EMBOSS, перейдите в локальный каталог. чуть выше того места, где вы хотите видеть созданный каталог EMBOSS.Например если вы хотите, чтобы EMBOSS отображался как / home / joe / src / emboss ... затем перейдите в / home / joe / src, затем проверьте репозиторий, набрав:

     cvs -d: pserver: [email protected]: / home / repository / emboss checkout emboss 

    Или, если вы хотите обновить ранее проверенное дерево исходного кода:

     cvs -d: pserver: [email protected]: / home / repository / emboss update 

    Вы можете выйти с сервера CVS с помощью:

     cvs -d: pserver: cvs @ cvs.open-bio.org:/home/repository/emboss выйти 

    (это сервер только для чтения).

    Q) Как мне скомпилировать версию CVS?

    A) Для этого вам понадобятся automake, autoconf, (GNU) make и libtool.

    Рекомендуется компилятор gcc. Компилятор хоста cc должен работать. (Обратите внимание, что некоторым компиляторам, отличным от gcc, может потребоваться добавление --include-deps в командную строку automake.)

    Если у вас есть системные версии инструментов GNU, которые случайно более новые, чем инструменты GNU, используемые в дереве исходных текстов EMBOSS тогда перед тем, как начать, может потребоваться ввести autoreconf -fiv.

    Пользователи MacOSX CVS также должны использовать 'autoreconf -fiv' после скачивание исходников.

    Затем введите:

     aclocal -I m4 autoconf automake -a # --include-deps # некоторые компиляторы, отличные от gcc ./configure # --enable-warnings - полезный переключатель для разработчиков сделать 

    Для получения дополнительной информации о возможности настройки сборки попробуйте

     ./configure --help 

    Q) Можете ли вы привести пример, как установить пакет ПОСОЛЬСТВА

    A) Вот как установить PHYLIP с учетом различных способов установки основной пакет EMBOSS.

    а) из анонимного кода резюме.

     1) Перейдите в каталог phylip посольство компакт-дисков / phylipnew 2) сделать конфигурационный файл местный autoconf автопроизводитель 3) настроить и скомпилировать ./configure (используйте те же параметры, что и при компиляции тиснения, особенно префикс -)) сделать сделать установку 

    б) из PHYLIP-3.6b.tar.gz

    доступно с нашего FTP-сервера ftp: // emboss.open-bio.org/pub/EMBOSS/ в файле PHYLIP-3.6b.tar.gz

    Если вы выполнили полную установку EMBOSS с префиксом например вы настроили с помощью ./configure --prefix = / usr / local / emboss а затем выполните команду make install (настоятельно рекомендуется), затем:

     1) распаковать и распаковать файл куда угодно gunzip ФИЛИП-3.6b.tar.gz tar xf PHYLIP-3.6b.tar 2) перейдите в каталог phylip компакт-диск PHYLIP-3.6b 3) настроить и скомпилировать ./ configure (используйте те же параметры, что и при компиляции тиснения, особенно префикс -)) сделать сделать установку N.B. Если вы настроили без префикса, но сделали 'make install' (или укажите префикс / usr / local, что равносильно тому же), то вы должны настроить с помощью: ./configure --prefix = / usr / local --enable-localforce 

    Если, с другой стороны, вы не выполнили «make install» EMBOSS тогда:

     1) Зайдите в каталог для тиснения компакт-диск ЭМБОСС-6.0,1 2) создайте новый справочник посольства, если он еще не существует. посольство мкдир 3) Зайдите в этот каталог посольство компакт-дисков 4) распаковать и распаковать файл gunzip ФИЛИП-3.6b.tar.gz tar xvf PHYLIP-3.6b.tar 5) перейдите в каталог phylip компакт-диск PHYLIP-3.6b 6) настроить и скомпилировать ./configure (используйте те же параметры, что и для компиляции тиснения) сделать 7) Установите PATH, чтобы включить полный путь к 'src' каталог 

    Q) Могу ли я изменить расположение файлов ACD?

    A) EMBOSS найдет файлы acd в каталоге установки или в исходный исходный каталог (в зависимости от того, как вы его настроили), поэтому обычно нет причин менять это.Тем не мение, если вы хотите это сделать, то это можно сделать в файле emboss.default (или ~ / .embossrc):
     env emboss_acdroot / usr / local / share / EMBOSS / acd 
    или установив переменную среды в командной строке:
     setenv EMBOSS_ACDROOT / usr / local / share / EMBOSS / acd 

    Q) Какие преимущества я получаю от использования связанных версий программного обеспечения.

    А) а) Вы можете прочитать любой тип последовательности, с которым может справиться тиснение.

    б) соответствующее программное обеспечение будет использовать файлы ACD для тиснения, чтобы именование выходных / входных файлов позаботится и проверит все значения перед запуском программы.Используются аргументы командной строки вместо интерактивных меню.

    Q) У меня установлен Emboss на нашем сервере разработки, и я готовлю отправка, которая отправит его примерно на 20 удаленных сайтов.

    Я запустил configure с параметром --prefix для установки в частный каталог. Я также собрал все файлы данных (rebase, transfac и т. Д.), Чтобы другой каталог и извлек из него информацию с соответствующими программы.

    Мое намерение состояло в том, чтобы просто перенести установочный каталог Emboss и Каталог данных для всех сайтов, используя при необходимости символические ссылки, чтобы пути к каталогам совпадают.

    Однако при тестировании я обнаружил несколько проблем;

    1) Хотя программы Emboss работают, я не вижу извлеченных данные.

    Например, remap выдает ошибку;

     EMBOSS Ошибка в remap.c в строке 167: Не удается найти файл фермента. Запустите REBASEEXTRACT 

    И это несмотря на то, что у меня установлены как Emboss, так и Data каталоги в том же месте, что и на машине разработки (которая работает).

    2) Другая серьезная проблема заключается в том, что я больше не вижу, что мои базы данных определены в emboss.default. Опять же, файл существует и находится в том же месте, что и на машина для разработки, но коробка, в которую она передана, дает пустой список из showdb.

    Кто-нибудь знает, где Emboss хранит информацию о местонахождении эти файлы? Он не мог ничего установить кроме оригинала каталог установки (не был установлен как root), поэтому я предполагаю, что проблема возникает из-за того, что программа в какой-то момент разрешает символические ссылки.

    A) Это внутри двоичных файлов ...

    EMBOSS «знает» расположение файлов, потому что он загружается во время configure, когда вы создаете свою копию, и включены в двоичные файлы.

    Вы можете увидеть это во время компиляции, особенно ajnam.c (где он используется):

     -DAJAX_FIXED_ROOT = \ "/ полный / источник / путь \" -DPREFIX = \ "/ install / prefix / path \" 

    Чтобы скопировать двоичные файлы, вам необходимо определить переменные среды для переопределить определения времени компиляции, если вы не можете сделать путь (е.г. / usr / local) одинаково для установок на каждом сайте.

    emboss.default также может устанавливать переменные среды, но вам нужно указать EMBOSS, где найти этот файл.

     setenv EMBOSS_ROOT / каталог / для / по умолчанию / файл 

    а затем в файле emboss.default вы можете установить:

     УСТАНОВИТЬ EMBOSS_ACDROOT / install / dir / share / EMBOSS / acd 

    или (это отменяет его) вы можете использовать другую переменную среды:

     УСТАНОВИТЬ EMBOSS_ACDROOT / install / dir / share / EMBOSS / acd 

    Q) Я загрузил исходный код Emboss и установил его для использования в XYZ Университет без проблем.В руководстве по администрированию есть советы по настройке программного обеспечения с помощью emboss.default, а также примеры для разрешение доступа к индексам SRS. Похоже, это делается через программу getz, который не является частью пакета Emboss.

    A) Если у вас установлен SRS (то есть у вас есть локальные индексные файлы SRS), вы иметь локальную копию программы getz, которая является частью SRS.

    Если у вас нет SRS, вы можете создать свои собственные индексные файлы с помощью dbiflat, dbigcg (если у вас есть GCG), dbiblast (если у вас есть blast) и dbifasta.Это обычное решение для сайтов, на которых не используется другая индексация баз данных.

    Вы также можете использовать серверы SRS удаленно, чтобы получать отдельные записи, используя их URL-адреса. Никакого дополнительного программного обеспечения не требуется (EMBOSS просто использует протокол HTTP).

    Конечно, если вам действительно нужно построить свои собственные индексы SRS, вы мог его установить. SRS - коммерческий продукт, но академические лицензии имеется в наличии. Но поскольку я сейчас работаю на разработчиков SRS, а это список рассылки ошибок EMBOSS, больше не скажу :-)

    Q) Я не получаю полные статические файлы даже при настройке с --disable-shared

    A) Это чаще всего происходит при использовании GNU LD.Если и общие, и существуют статические версии библиотеки, тогда GNU LD примет общая библиотека по желанию. Корень этой проблемы - libtool. Однако вы можете принудительно настроить полные статические изображения, добавив определение вашей строки "make":
     сделать "LDFLAGS = -Wl, -static" 

    Q) Какие варианты графики доступны?

    А) Чтобы посмотреть, какие графические драйверы доступны типа? на промет для тип графика, и это даст вам список.

    Вот некоторые из них: -

     ps -> Постскриптум cps -> Цветной постскрипт x11 -> отображение X.(также называемые xterm и xwindows) hpgl -> HP Laserjet III, режим эмуляции HPGL. png -> PNG (для этого вам понадобятся библиотеки png, z и gd) tek -> Терминал Tektronix нет -> нет. data -> Записывает точки в файл для графиков. meta -> мета-файл plplot. 

    Q) Плоттеры и цвета перьев.

    A) Драйверы HP предполагают, что перья загружены следующим образом: -
     SP1 Красный SP2 желтый SP3 Зеленый SP4 Синий SP5 Пурпурный SP6 Белый / Выкл. SP7 Черный SP8 Голубой 
    В противном случае ваш результат будет иметь разные цвета.В) Просматривая сайт Gnu, я наткнулся на утилиты libplot, libxmi и plot. Подойдут ли они для замены PLPLOT? A) Пока что они все еще под лицензией GPL, а не LGPL. Роберт Майер пообещал LGPL некоторое время назад, но пока не сделал этого. Жалость ad это имеет значение для ссылки в сторонних приложениях на ЭМБОСС.

    Q) Я получаю сообщения об ошибках, когда пытаюсь отобразить X11 на моем ПК. Я использую эмулятор Hummingbird Exceed X11.

    A) Это должно касаться только версий EMBOSS до 5.0,0

    Эмулятор Hummingbird Exceed X11 (и, возможно, другие системы) использует По умолчанию отображается TrueColor.

    Вы должны изменить настройки конфигурации так, чтобы она использовала «ПсевдоЦвет». В версии 6.1 Hummingbird Exceed это делается нажатием на Раздел Exceed на панели инструментов Windows 98 внизу экрана. Выберите «Инструменты», затем «Конфигурация», затем «Определение экрана».

    Появится окно. Во всплывающем меню «Server Visual» слева выберите «PseudoColor».Щелкните "ОК".


    В) Как мне использовать свой собственный файл личных данных?

    A) Вы можете изменить один из стандартных файлов данных EMBOSS. Один из файлы данных, которые вы, возможно, захотите изменить, являются файлами таблиц перевода.

    transeq был написан для чтения только в одном из стандартных файлы перевода:

     EGC.0 EGC.1 EGC.2 EGC.3 EGC.4 EGC.5 EGC.6 EGC.9 EGC.10 EGC.12 EGC.11 EGC.13 EGC.14 EGC.15 

    Это единственные файлы, которые вы можете указать в transeq.

    Если вы хотите создать свою собственную специализированную таблицу перевода, тогда вы следует выбрать один из них, чтобы изменить его.

    Например, вы можете решить, что будете использовать файл EGC.15 в качестве никогда бы не захотел использовать это иначе.

    Используйте программу embossdata, чтобы получить копию этого файла:

     % embossdata -fetch-имя файла EGC.15 Находит или извлекает файлы данных, считанные программами EMBOSS Файл '/packages/emboss/emboss/data/EGC.15' успешно скопирован.

    Отредактируйте файл EGC.15 в соответствии со своими требованиями.

    Укажите «-таблица 15» при запуске «transeq», чтобы использовать этот измененный файл. 'transeq' будет искать файл 'EGC.15' и найдет его в вашем текущий каталог, прежде чем он найдет каталог по умолчанию в EMBOSS_DATA каталог. Поэтому он будет использовать вашу локальную копию.

    Вы можете запутаться в большом количестве копий измененных файлов. Чтобы проверить, какая копия файла используется - по умолчанию EMBOSS_DATA одна или потенциальная локальная копия, используйте "embossdata":

     % embossdata-имя файла EGC.15 Находит или извлекает файлы данных, считанные программами EMBOSS # Следующие каталоги могут содержать файлы данных EMBOSS. # Они ищутся в следующем порядке, пока не будет найден файл. # Если каталог не существует, это указано ниже. # '.' это имя UNIX для вашего текущего рабочего каталога. Файл ./EGC.15 существует Файл .embossdata / EGC.15 Не существует Файл /people/gwilliam/EGC.15 Не существует Файл / people / gwilliam /.embossdata / EGC.15 Не существует Файл /packages/emboss/emboss/data/EGC.15 существует 

    Это показывает, что копия EGC.15 существует в вашем текущем каталоге и поэтому будет использоваться вместо значения по умолчанию в EMBOSS_DATA каталог.


    Q) Как записывать последовательности в разные файлы вместо того, чтобы писать их? все в один файл?

    A) EMBOSS не умеет записывать несколько последовательностей в разные файлы. Вы можете попробовать использовать nthseq для извлечения одной последовательности за раз.

    Вам следует подумать об использовании квалификатора -ossingle. Это пишет последовательности для разделения файлов FASTA, но имена файлов зависят от ID последовательности. Это редко используется. Это потому, что -ossingle по умолчанию для формата вывода GCG. Имя выходного файла в настоящее время игнорируется когда используется ossingle, и имя файла зависит от каждого человека последовательность.

    Q) Какие форматы последовательностей поддерживаются?

    А) Многие:

    gcg, embl, swissprot, fasta, ncbi, genbank, nbrf, codata, strider, clustal, phylip, acedb, msf, ig, staden, текст, raw, asis

    Q) В чем разница между форматами TEXT и RAW?

    A) TEXT принимает все в файле последовательности как последовательность.RAW принимает только буквенно-цифровые символы и пробелы и отклоняет что-нибудь еще.

    Q) Что такое формат ASIS?

    A) «Имя файла» - это действительно последовательность. Это быстрый и простой способ прочитать короткий отрывок из последовательность без необходимости вводить ее в файл.

    Например:

     % program -seq asis :: ATGGTGAGGAGAGTTGTGATGAGA 

    Q) У меня есть очень короткие белковые последовательности, которые, по мнению EMBOSS, нуклеиновые последовательности. Как заставить EMBOSS относиться к ним как к нуклеиновой кислоте последовательности?

    Например:
     > кошка seq1 А > кошка seq2 я % water seq1 seq2 -stdout -auto Местный расклад Смита-Уотермана.Обнаружена ошибка: последовательность не нуклеиновая 

    Здесь `` вода '' автоматически (и ошибочно) думает, что A - это аденозин. вместо аланина и не работает, когда читает в seq2 и ожидает найти другую последовательность нуклеиновой кислоты - но «I» не является допустимым основанием и так что это не удается.

    A) Для многих форматов последовательностей нет возможности указать последовательность введите файл, чтобы EMBOSS угадал.

    Есть флаг, который может заставить программы EMBOSS обрабатывать последовательности как нуклеиновая кислота или белок.

     'water -help -verbose' 

    показывает полный список квалификаторов последовательности.

    Если вы выполните последовательность USA с «-sprotein», EMBOSS проверит что это действительная последовательность белка.

    Если вам нужно заставить последовательность быть ДНК, квалификатор '-нуклеотид'

    Квалификатор должен следовать за последовательностью, чтобы применяться к одной последовательности, или может идти в начале командной строки, чтобы ссылаться на все последовательности, для пример:

     'вода -спротеин seq4 seq3 -stdout -auto' 

    Вы также можете использовать '-sprotein1' в любом месте командной строки для ссылки к первой последовательности и «-спротеин2» для обозначения второй последовательности.

    Конечно, как и все квалификаторы EMBOSS, вы можете сокращать их так долго поскольку они все еще уникальны. В этом случае будут работать '-sp' и '-sn' (или «-sp1» и «-sp2», если вам нужны числа).


    В) Есть ли максимальный размер для последовательностей?

    A) Максимальный размер любой программы зависит только от того, сколько памяти у вас система имеет.

    Конечно, некоторые программы (и некоторые параметры программ) тоже могут много памяти, или просто работать очень медленно.

    У вас может быть ограничение на использование памяти.

    Попробуйте использовать команду Unix limit, чтобы посмотреть на такие ограничения.

    Попробуйте использовать команду Unix unlimit, чтобы снять ограничения, например:

     % unlimit stacksize % unlimit vmemoryuse 

    Q) GCG имеет несколько произвольный предел длины фрагмента 2500 п.н. для геля *. Есть ли аналогичный предел для MSE в EMBOSS?

    A) Нет. MSE не имеет ограничений, вы ограничены только объемом памяти. иметь.

    Q) Я пытаюсь написать веб-интерфейс для программы для тиснения. и запустите apache.Программа жалуется, что нет ДОМА каталог установлен.

    A) Просто поместите их вверху после ваших операторов «использовать CGI» (что угодно).
     $ ENV {HOME} = т.е. / usr / local / apache $ ENV {EMBOSS_DATA} = 

    Эти два важны, но вы также можете передать другие «константы».


    Q) Построение графика с помощью pepwheel дает интересный результат. pepwheel -turns = 8 -send = 30 sw: p77837 -auto дает график винтового колеса, но остатки нанесены так, что каждые два круги сидят один на другом.

    А) Это правильный ответ.

    Вместо 3,6 остатков на ход (5 поворотов за 18 шагов) вы, кажется, иметь спираль с 8 витками в 18 шагов (4 в 9).

    Попробуйте -turns = 4 -steps = 9 ... но только если вы уверены, что это как идет твоя спираль.

    Я полагаю, мы могли бы поиграть с проверкой общих факторов в pepwheel, но я не знаю ни одной биологически значимой обстановки, которая могла бы вызвать проблемы.

    Q) В prettyplot, как указать имя выходного файла для файла графика?

    А)
     Prettyplot -auto ~ / wordtest / globin-nogap.msf -graph ps Создан prettyplot.ps 

    Имя генерируется автоматически. Чтобы установить это на что-то большее Дискриптивное использование -go .i.e

     prettyplot -auto ~ / wordtest / globin-nogap.msf -graph ps -go = привет Создан hello.ps 

    Q) В редакторе 'mse', но я не знаю, как сохранить мои отредактированные последовательности в конце сеанса редактирования.

    A) Используйте Control-Z, чтобы перейти в командный режим.

    Затем используйте команду SAVE, которая запросит имя файла.

    Q) Я хотел бы знать, может ли EMBOSS выполнять сборку нуклеотидного контига аналогична функции GCG gelproject / gelview. И если да, то это есть какие-либо ограничения размера на количество базовых пар и количество контиги? благодарю вас.

    A) EMBOSS не распространяется на сборку контигов, которую вы описываете. Мы предоставили обертку EMBOSS для пакета MIRA.
    .

    Смотрите также